معرفی شرکت ها
fastqe-0.2.7
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشترتوضیحات
A emoji based bioinformatics command line tool
| ویژگی | مقدار |
|---|---|
| سیستم عامل | - |
| نام فایل | fastqe-0.2.7 |
| نام | fastqe |
| نسخه کتابخانه | 0.2.7 |
| نگهدارنده | [] |
| ایمیل نگهدارنده | [] |
| نویسنده | Andrew Lonsdale |
| ایمیل نویسنده | andrew.lonsdale@lonsbio.com.au |
| آدرس صفحه اصلی | https://github.com/fastqe/fastqe |
| آدرس اینترنتی | https://pypi.org/project/fastqe/ |
| مجوز | BSD-3-Clause |
# FASTQ with Emoji = FASTQE 🤔
Read one or more FASTQ files, [fastqe](https://fastqe.com/) will compute quality stats for each file and print those stats as emoji... for some reason.
Given a fastq file in Illumina 1.8+/Sanger format, calculate the mean (rounded) score for each position and print a corresponding emoji!
https://fastqe.com/
# Install
Latest release versions of `fastqe` are available via `pip` or BioConda:
`pip install fastqe`
`conda install -c bioconda fastqe`
## Development
Development version can be isntall from this repository in the `master` branch.
# Usage
`fastqe` can display usage information on the command line via the `-h` or `--help` argument:
```
usage: fastqe [-h] [--minlen N] [--scale] [--version] [--mean]
[--custom CUSTOM_DICT] [--bin] [--noemoji] [--min] [--max]
[--output OUTPUT_FILE] [--long READ_LENGTH] [--log LOG_FILE]
[FASTQ_FILE [FASTQ_FILE ...]]
Read one or more FASTQ files, compute quality stats for each file, print as
emoji... for some reason.😄
positional arguments:
FASTQ_FILE Input FASTQ files
optional arguments:
-h, --help show this help message and exit
--minlen N Minimum length sequence to include in stats (default
0)
--scale show relevant scale in output
--version show program's version number and exit
--mean show mean quality per position (DEFAULT)
--custom CUSTOM_DICT use a mapping of custom emoji to quality in
CUSTOM_DICT (🐍🌴)
--bin use binned scores (🚫💀💩⚠️😄😆😎😍)
--noemoji use mapping without emoji (▁▂▃▄▅▆▇█)
--min show minimum quality per position
--max show maximum quality per position
--output OUTPUT_FILE write output to OUTPUT_FILE instead of stdout
--long READ_LENGTH enable long reads up to READ_LENGTH bp long
--log LOG_FILE record program progress in LOG_FILE
```
## Convert
`fastqe` will summarise FASTQ files to display the max, mean and minumum quality using emoji. To convert a file into this format, rather than summarise, you can use the companion program `biomojify` that will convert both sequence and quality information to emoji:
```
$ cat test.fq
@ Sequence
GTGCCAGCCGCCGCGGTAGTCCGACGTGGC
+
GGGGGGGGGGGGGGGGGGGGGG!@#$%&%(
```
```
$ biomojify fastq test.fq
▶️ Sequence
🍇🍅🍇🌽🌽🥑🍇🌽🌽🍇🌽🌽🍇🌽🍇🍇🍅🥑🍇🍅🌽🌽🍇🥑🌽🍇🍅🍇🍇🌽
😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁😁🚫😄👺💔🙅👾🙅💀
```
Intall with `pip install biomojify`, and see the `biomojify` page for more information: https://github.com/fastqe/biomojify/
# Quickstart
`fastqe test.fastq`
`fastqe --min test.fastq`
`fastqe --max test.fastq`
`fastqe --max -min -bin test.fastq`
# Teaching Materials
## Command line and NGS Introduction
This lesson introduces NGS process in the command line using by using the results of FASTQE before and after quality filerting
using `fastp`:
[https://qubeshub.org/publications/1092/2](https://qubeshub.org/publications/1092/2)
```
Rachael St. Jacques, Max Maza, Sabrina Robertson, Guoqing Lu, Andrew Lonsdale, Ray A Enke (2019).
A Fun Introductory Command Line Exercise: Next Generation Sequencing Quality Analysis with Emoji!.
NIBLSE Incubator: Intro to Command Line Coding Genomics Analysis, (Version 2.0).
QUBES Educational Resources. doi:10.25334/Q4D172
```
## Galaxy
A Galaxy wrapper is available from the [IUC toolshed](https://toolshed.g2.bx.psu.edu/repository?repository_id=13576f42f394cfb6). Contact your Galaxy Admin
if you would like to have it installed. A Galaxy Tutorial using FASTQE is in development.
# History
FASTQE started out as part of PyCon Au presentations:
- PyCon Au 2016 - [Python for science, side projects and stuff!](https://www.youtube.com/watch?v=PCZS9wqBUuE)
- PyCon Au 2017 - [Lightning Talk](https://youtu.be/WywQ6a3uQ5I?t=33m18s)
- BCC 2020 - Short Presentaion
<img src="docs/img/fastqe.png" class="img-fluid" alt="Responsive image">
### Versions
- version 0.0.1 at PyCon Au 2016:
- Mean position per read
- version 0.0.2 at PyconAu 2017:
- update emoji map
- Max and minimum scores per position added
- Wrapper code based on early version of [Bionitio](https://github.com/bionitio-team/bionitio) added
- prepare for PyPi
- version 0.1.0 July 2018
- clean up code
- add binning
- version 0.2.6 July 2020
- refactor code
- add long read support with --long
- add --noemoji for block-based output on systems that don't support emoji
- add --custom for user-defined mapping to emoji
- add --output to redirect to file instead of stdout
- add gzip support
- add redirect from stdin support
- fix bug of dropping position if some sequences are only 0 quality
- Galaxy Wrapper created July 2020
- `biomojify` created July 2020
# Limitations
- ~Reads up to 500bp only~ Read length above 500bp allowed but must be set by user with `--long MAX_LENGTH`
- Same emoji for all scores above 41
## Licence
This program is released as open source software under the terms of [BSD License](https://raw.githubusercontent.com/fastqe/fastqe/master/LICENSE)
## Dependencies
- pyemojify
- BioPython
- NumPy
## Roadmap
- [x] Rearrange emoji to use more realistic ranges (i.e > 60 use uncommon emoji) and remove inconsistencies
- [x] ~Add conversion to emoji sequence format, with/without binning, for compressed fastq data~ fits into https://github.com/fastqe/biomojify/
- [ ] Rewrite conversion to standalone function for use in iPython etc.
- [ ] Teaching resources
- [ ] Test data and unit tests
- [x] ~Add FASTA mode for nucleotide and proteins emoji~ see https://github.com/fastqe/biomojify/
- [ ] MultiQC plugin
- [ ] ~Galaxy Wrapper~: available form the [IUC toolshed](https://toolshed.g2.bx.psu.edu/repository?repository_id=13576f42f394cfb6)
Rather convert to emoji than summarise? We've just started `biomojify` for that: https://github.com/fastqe/biomojify/
# Contributors
- Andrew Lonsdale
- Björn Grüning
- Catherine Bromhead
- Clare Sloggett
- Clarissa Womack
- Helena Rasche
- Maria Doyle
- Michael Franklin
- Nicola Soranzo
- Phil Ewels
## Scale
Use the `--scale` option to include in output.
```
0 ! 🚫
1 " ❌
2 # 👺
3 $ 💔
4 % 🙅
5 & 👾
6 ' 👿
7 ( 💀
8 ) 👻
9 * 🙈
10 + 🙉
11 , 🙊
12 - 🐵
13 . 😿
14 / 😾
15 0 🙀
16 1 💣
17 2 🔥
18 3 😡
19 4 💩
20 5 ⚠️
21 6 😀
22 7 😅
23 8 😏
24 9 😊
25 : 😙
26 ; 😗
27 < 😚
28 = 😃
29 > 😘
30 ? 😆
31 @ 😄
32 A 😋
33 B 😄
34 C 😝
35 D 😛
36 E 😜
37 F 😉
38 G 😁
39 H 😄
40 I 😎
41 J 😍
```
Binned scale:
```
0 ! 🚫
1 " 🚫
2 # 💀
3 $ 💀
4 % 💀
5 & 💀
6 ' 💀
7 ( 💀
8 ) 💀
9 * 💀
10 + 💩
11 , 💩
12 - 💩
13 . 💩
14 / 💩
15 0 💩
16 1 💩
17 2 💩
18 3 💩
19 4 💩
20 5 ⚠️
21 6 ⚠️
22 7 ⚠️
23 8 ⚠️
24 9 ⚠️
25 : 😄
26 ; 😄
27 < 😄
28 = 😄
29 > 😄
30 ? 😆
31 @ 😆
32 A 😆
33 B 😆
34 C 😆
35 D 😎
36 E 😎
37 F 😎
38 G 😎
39 H 😎
40 I 😍
41 J 😍
```
## Custom
Use a dictionary of [Pyemojify mappings](https://github.com/lord63/pyemojify/blob/master/pyemojify/emoji.py) in a text file instead of built in emoji choices:
```
{
'#': ':no_entry_sign:',
'\"': ':x:',
'!': ':japanese_goblin:',
'$': ':broken_heart:'
}
```
Emoji characters can also be used directlty instead (experimental):
```
{
'#': ':no_entry_sign:',
'\"': ':x:',
'!': '👿',
'$': ':broken_heart:'
}
```
نیازمندی
| مقدار | نام |
|---|---|
| >=1.66 | biopython |
| - | pyemojify |
نحوه نصب
نصب پکیج whl fastqe-0.2.7:
pip install fastqe-0.2.7.whl
نصب پکیج tar.gz fastqe-0.2.7:
pip install fastqe-0.2.7.tar.gz