معرفی شرکت ها
edittag-1.1
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشترتوضیحات
Design and check sets of edit metric sequence tags.
| ویژگی | مقدار |
|---|---|
| سیستم عامل | - |
| نام فایل | edittag-1.1 |
| نام | edittag |
| نسخه کتابخانه | 1.1 |
| نگهدارنده | [] |
| ایمیل نگهدارنده | [] |
| نویسنده | Brant Faircloth |
| ایمیل نویسنده | brant.faircloth+edittag@gmail.com |
| آدرس صفحه اصلی | http://github.com/faircloth-lab/edittag/ |
| آدرس اینترنتی | https://pypi.org/project/edittag/ |
| مجوز | http://www.opensource.org/licenses/BSD-3-Clause |
Copyright (c) 2009-2012 Brant C. Faircloth. All rights reserved.
- See **LICENSE.md** for standard computer code.
- Sequence tags available from
https://github.com/faircloth-lab/edittag/downloads are licensed under
`Creative Commons Attribution 3.0 United States License`_.
Description
-----------
edittag is a software collection for designing sets of edit metric
sequence tags, checking sequence tags for conformation to the edit
metric, and integrating sequence tags to platform-specific sequencing
adapters and PCR primers. edittag differs from other approaches:
- edittag generates arbitrary lengths of edit-metric sequence tags in
reasonable time frames using multiprocessing
- edittag produces edit metric sequence tag sets conform to the edit
distance selected
- edittag used primer3 to integrate sequence tags to PCR primers
We provide several large sets of edit metric sequence tags designed
using edittag in the following formats:
- text_ - this file is in an appropriate format for `check_levenshtien_distance.py`
- csv_
- `sqlite database`_
Documentation
-------------
You can find documentation here:
http://faircloth-lab.github.com/edittag/
Citation
--------
Faircloth BC, Glenn TC. Large sets of edit-metric sequence identification
tags to facilitate large-scale multiplexing of reads from massively
parallel sequencing. `http://precedings.nature.com/documents/5672/version/1`_
Dependencies
------------
- `Python 2.7.x`_ (should work on 2.6.x)
- `numpy`_ (tested with 1.5.1)
- `py-levenshtein`_ [optional - strongly recommended]
- `mod-primer3`_ [optional - needed for amplicon tagging]
- `nose`_ [optional - for unittests]
Availability
------------
- tar.gz
- repository
Installation
------------
easy_install
~~~~~~~~~~~~
::
easy_install edittag
tar.gz
~~~~~~~
::
wget package.tar.gz
tar -xzf package.tar.gz
python setup.py install
repository
~~~~~~~~~~~~
::
git clone git://github.com/faircloth-lab/edittag.git edittag
optional package (py-levenshtein)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
::
wget http://pylevenshtein.googlecode.com/files/python-Levenshtein-0.10.1.tar.bz2
tar -xzvf python-Levenshtein-0.10.1.tar.bz2
python setup.py install
optional package (primer3)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~
If you wish to design primers incorporating edit metric sequence tags, you
need to first install a modified version of primer3:::
git clone git://github.com/baddna/mod-primer3.git
cd mod-primer3/src
make
Ensure that you move the binaries from mod-primer3 to a location in your
path (move at least ``primer3-long`` and ``primer3_config`` into identical
directories in your path).
Testing
--------
::
# Testing requires numpy and nose
import edittag
edittag.test()
Using edittag
---------------
::
# generate some tags
% design_edit_metric_tags.py --tag-length=6 --edit-distance=3 \
--no-polybase --gc --comp --min-and-greater --output tmp/tags.txt
# validate the 6 nucleotide, edit distance 3 tag set
% validate_edit_metric_tags.py
--input=tmp/tags.txt
--section='6nt ed3'
--verbose
# add those tags to a primer set
% add_tags_to_primers.py --left-primer=GTTATGCATGAACGTAATGCTC
--right-primer=CGCGCATGGTGGATTCACAATCC \
--input tmp/tags.txt --section='6nt ed3'
--sort=pair_hairpin_either,pair_penalty,cycles \
--remove-common --keep-database \
--output tmp/trnH_tagged_with_10_nt_ed_5_tags.csv
.. _`https://github.com/BadDNA/edittag/downloads`: https://github.com/BadDNA/edittag/downloads
.. _`http://precedings.nature.com/documents/5672/version/1`: http://precedings.nature.com/documents/5672/version/1
.. _Creative Commons Attribution 3.0 United States License: http://creativecommons.org/licenses/by/3.0/us/
.. _text: https://github.com/downloads/faircloth-lab/edittag/edit_metric_tags.txt
.. _csv: https://github.com/downloads/faircloth-lab/edittag/edit_metric_tags.csv
.. _sqlite database: https://github.com/downloads/faircloth-lab/edittag/edit_metric_tags.sqlite.zip
.. _Python 2.7.x: http://www.python.org/
.. _numpy: http://numpy.scipy.org
.. _py-levenshtein: http://pylevenshtein.googlecode.com
.. _mod-primer3: https://github.com/BadDNA/mod-primer3
.. _nose: http://somethingaboutorange.com/mrl/projects/nose/1.0.0/
نحوه نصب
نصب پکیج whl edittag-1.1:
pip install edittag-1.1.whl
نصب پکیج tar.gz edittag-1.1:
pip install edittag-1.1.tar.gz