[](https://travis-ci.org/smsaladi/codonpair)
[](https://badge.fury.io/py/codonpair)
[](https://data.caltech.edu/badge/latestdoi/77872126)
codonpair
=========
`codonpair` calculates codon pair score and codon pair bias. CPS
values are identical to those produced by the perl script from
Dimitris Papamichail (`cps_perl` directory) and, presumably,
used in the following work:
Virus attenuation by genome-scale changes in codon pair bias.
Coleman JR1, Papamichail D, Skiena S, Futcher B, Wimmer E, Mueller S.
Science. 2008 Jun 27;320(5884):1784-7. doi: 10.1126/science.1155761.
https://www.ncbi.nlm.nih.gov/pubmed/18583614
## Installation
Either, clone the repo and install with pip
```shell
git clone git@github.com:smsaladi/codonpair.git
pip install ./codonpair
```
Or... have pip handle the details:
```shell
pip install git+git://github.com/smsaladi/codonpair@master#codonpair
```
All dependencies should be checked for and, if necessary, installed
automatically by `pip`.
## Usage
Initialize a `codonpair.CodonPair` object by specifying a list of reference sequences
`CodonPair.from_sequences`, from a named reference `CodonPair.from_named_reference`,
a reference file `CodonPair.from_reference_file`,
or simply providing a `pd.DataFrame` with codon counts to `CodonPair`.
The following named references are recognized/bundled with this package.
* `E. coli` (BL21 DE3)
* `S. pneumoniae` (TIGR4)
* `cps_perl` - the reference file provided with the perl implementation
The default constructor `CodonPair()` uses the `E. coli`.
Then calculate the codon pair score for a provided sequence with `CodonPair.cpb`
which returns a dictionary with the
* total codon pair score `total_cps` - the sum of the values of each codon pair
* the number of codons `n_pair` - excluding codon pairs not found in the reference
* the codon pair bias `cpb` - `total_cps/n_pair`
For one-off calculations, `codonpair.calc_cpb` can be used directly
for with the sequence of interest (calling the default constructor under the hood).
```python
import codonpair
cp = codonpair.CodonPair.from_named_reference('E. coli')
cp.cpb("ATGATCCCCTTACAACATGGACTGATCCTCGCGGCAATCTTATTCGTTCTTGGCTTAACC")
```
For convenience, the executable `cps` installed into the path by pip:
```bash
cps test.fasta > test.scores.txt
```
See `CodonPair.write_reference` to write codon pair counts for a reference set to
the filename provided to be used with future calculations.
