معرفی شرکت ها

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

توضیحات

Bioinformatics Test Data Generator

ویژگی	مقدار
سیستم عامل	-
نام فایل	biotdg-0.1.0
نام	biotdg
نسخه کتابخانه	0.1.0
نگهدارنده	[]
ایمیل نگهدارنده	[]
نویسنده	Leiden University Medical Center
ایمیل نویسنده	sasc@lumc.nl
آدرس صفحه اصلی	https://github.com/biowdl/biotdg
آدرس اینترنتی	https://pypi.org/project/biotdg/
مجوز	MIT

.. Badges have empty alts. So nothing shows up if they do not work. .. image:: https://img.shields.io/pypi/v/biotdg.svg :target: https://pypi.org/project/biotdg/ :alt: .. image:: https://img.shields.io/conda/v/bioconda/biotdg.svg :target: http://bioconda.github.io/recipes/biotdg/README.html :alt: .. image:: https://img.shields.io/pypi/pyversions/biotdg.svg :target: https://pypi.org/project/biotdg/ :alt: .. image:: https://img.shields.io/pypi/l/biotdg.svg :target: https://github.com/biowdl/biotdg/blob/master/LICENSE :alt: .. image:: https://travis-ci.com/biowdl/biotdg.svg?branch=develop :target: https://travis-ci.com/biowdl/biotdg :alt: .. image:: https://codecov.io/gh/biowdl/biotdg/branch/develop/graph/badge.svg :target: https://codecov.io/gh/biowdl/biotdg :alt: biotdg: Bioinformatics Test Data Generator ========================================== ``biotdg`` can generate mutations based on vcf files for genomes where the chromosomes have different ploidy. It was made to create test genomes for pipelines that correctly handle the ploidy of sex chromosomes. It can also be used to create test data for pipelines that handle triploid species, such as banana, or for pipelines that discover chromosome imbalances, such as trisomy-21 (Down syndrome) and XXY males (Klinefelter syndrome). ``biotdg`` uses a reference genome, a ploidy table and a vcf file to create a "true genome" for a sample. For example, if the ploidy table states that ``chr21`` has a ploidy of 3 then the "true genome" will have three copies of ``chr21``. Each ``chr21`` copy will have its own mutations based on the vcf file. After creating the "true genome" fasta file. ``biotdg`` uses the `dwgsim <https://github.com/nh13/dwgsim>`_ program to generate fastq reads. Usage ----- .. code-block:: text usage: biotdg [-h] [--version] -r REFERENCE --vcf VCF -p PLOIDY_TABLE -s SAMPLE_NAME [-z RANDOM_SEED] [-l READ_LENGTH] [-C COVERAGE] [-e READ1_ERROR_RATE] [-E READ2_ERROR_RATE] [-n MAXIMUM_N_NUMBER] [-o OUTPUT_DIR] Bioinformatics Test Data Generator optional arguments: -h, --help show this help message and exit --version show program's version number and exit -r REFERENCE, --reference REFERENCE Reference genome for the sample. --vcf VCF VCF file with mutations. -p PLOIDY_TABLE, --ploidy-table PLOIDY_TABLE Tab-delimited file with two columns specifying the chromosome name and its ploidy. By default all chromosomes have a ploidy of 2. -s SAMPLE_NAME, --sample-name SAMPLE_NAME Name of the sample to generate. The sample must be in the VCF file. -z RANDOM_SEED, --random-seed RANDOM_SEED Random seed for dwgsim (default: 1). -l READ_LENGTH, --read-length READ_LENGTH Read length to be used by dwgsim. -C COVERAGE, --coverage COVERAGE Average coverage for the generated reads. NOTE: This is multiplied by the ploidy of the chromosome. -e READ1_ERROR_RATE, --read1-error-rate READ1_ERROR_RATE Same as -e flag in dwgsim. per base/color/flow error rate of the first read. -E READ2_ERROR_RATE, --read2-error-rate READ2_ERROR_RATE Same as -E flag in dwgsim. per base/color/flow error rate of the second read. -n MAXIMUM_N_NUMBER, --maximum-n-number MAXIMUM_N_NUMBER Maximum number of Ns allowed in a given read. -o OUTPUT_DIR, --output-dir OUTPUT_DIR Example ------- Given the following ``reference.fasta`` file .. code-block:: text >chr1 GATTACA GATTACA GATTACA >chrX AGTCAGTCAGTC >chrY AGAATC the following ploidy table.tsv .. code-block:: text chr1 3 chrX 2 chrY 1 and the following vcf: .. code-block:: text ##fileformat=VCFv4.1 ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##contig=<ID=chr1,length=21> ##contig=<ID=chrX,length=12> ##contig=<ID=chrY,length=6> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT sample1 chr1 4 . T A,C,G . . . GT 1/2/3 chr1 7 . A T . . . GT 0/1/0 chrX 1 . A T . . . GT 0/1 chrX 2 . G T . . . GT 0/0 chrY 4 . A C . . . GT 1 A "true genome" for sample1 looks like this: .. code-block:: text >chr1_0 GATAACAGATTACAGATTACA >chr1_1 GATCACTGATTACAGATTACA >chr1_2 GATGACAGATTACAGATTACA >chrX_0 AGTCAGTCAGTC >chrX_1 TGTCAGTCAGTC >chrY_0 AGACTC .. note:: Mutations are always generated in a phased manner. A ``_0`` chromosome will receive all the genotypes in the VCF that are at index 0 (the outer left one). This is true even if the variants are not described as phased in the vcf. Why ``biotdg`` and not ``dwgsim``? ---------------------------------- ``dwgsim`` has excellent capabilities for generating reads that are close to real data. Therefore ``dwgsim`` is used by ``biotdg`` in this capacity. ``dwgsim`` can also generate mutations randomly and output these in VCF format. It also has the capability to use a VCF to generate mutations. This VCF-based method was not deemed sufficient for the following reasons: + Very poorly documented. + Only allows ploidy of 1 or 2. There is an option '3' but that does something different. + How exactly mutations are generated is unknown. Is it aware of phasing? If so, how does it handle it? ``biotdg`` handles the creation of the "true genome" transparently and then uses dwgsim to generate reads. ``biotdg`` can handle genomes with mixed ploidies (as is the case for most species with a sex chromosome) well. Known limitations ----------------- + Overlapping mutations are not handled properly. (Probably not a concern for generating test data.) + Mutations are always generated in a phased manner. This was easier to implement than an unphased manner. It is also more transparent. Some extra work will be required to handle unphased generation of mutations. + ``biotdg`` is only tested with SNPs. Indels and other variant types were not tested. .. TODO: Test with indels.

نیازمندی

مقدار	نام
-	biopython
-	cyvcf2
-	setuptools

زبان مورد نیاز

مقدار	نام
>=3.6,<3.8	Python

نحوه نصب

نصب پکیج whl biotdg-0.1.0:

pip install biotdg-0.1.0.whl

نصب پکیج tar.gz biotdg-0.1.0:

pip install biotdg-0.1.0.tar.gz