معرفی شرکت ها

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

توضیحات

An unofficial python wrapper for the Benchling API

ویژگی	مقدار
سیستم عامل	-
نام فایل	benchlingapi-2.1.9
نام	benchlingapi
نسخه کتابخانه	2.1.9
نگهدارنده	['Justin Vrana']
ایمیل نگهدارنده	['justin.vrana@gmail.com']
نویسنده	Justin Vrana
ایمیل نویسنده	justin.vrana@gmail.com
آدرس صفحه اصلی	https://www.github.com/klavinslab/benchling-api
آدرس اینترنتی	https://pypi.org/project/benchlingapi/
مجوز	-

# BenchlingAPI [![PyPI version](https://badge.fury.io/py/benchlingapi.svg)](https://badge.fury.io/py/benchlingapi) The (unofficial) python API wrapper for Benchling. For more information, see documentation at https://klavinslab.github.io/benchling-api/index. ## Installation ``` pip install benchlingapi -U ``` ## Getting Started Initialize a session using your Benchling-provided API key: ```python from benchlingapi import Session session = Session("your_secret_benchling_api_key") ``` From there, you can access various models: ```python session.DNASequence session.AASequence session.Oligo session.Folder session.Project session.Registry session.Translation session.EntitySchema session.Batch session.CustomEntity ``` Finding models: ```python # get one model dna = session.DNASequence.one() # find a specific model by its id dna = session.DNASequence.find('sdg_4tg23') # get the last 50 amino acids proteins = session.AASequence.last(50) # get a registry by name registry = session.Registry.find_by_name("Klavins Lab Registry") ``` Updating models: ```python dna = session.DNASequence.one() dna.name = "My new name" dna.bases = "AGGTAGGGTAGGGCCAGAGA" # update the sequence on the server dna.update() ``` Saving new models: ```python folder = session.Folder.find_by_name("My API Folder") dna = session.DNASequence( name = 'my new dna', bases = 'AGGTAGGATGGCCA', folder_id = folder.id, is_circular = False ) # save the dna to your Benchling account dna.save() ``` Registering models to your registry: ```python dna.set_schema("My DNA Schema") dna.register() ``` See the documentation for more information: https://klavinslab.github.io/benchling-api/index ## Testing Testing is done using `pytest`. Tests will create live requests to a Benchling account. Since testing is done live, a Benchling account will need to be setup along with testing data. To run tests, you must have a Benchling Account with an API key. Tests require a file in 'tests/secrets/config.json' with the following format: ``` { "credentials": { "api_key": "asdahhjwrthsdfgadfadfgadadsfa" }, "sharelinks": [ "https://benchling.com/s/seq-asdfadsfaee" ], "project": { "name": "API" }, "trash_folder": { "name": "API_Trash" }, "inventory_folder": { "name": "API_Inventory" } } ``` On the Benchling side of things, in the account liked to the `credentials["api_key"]`, you must have a project corresponding to the `project["name"]` value above. Within this project, you should have two folder corresponding to the `trash_folder` and `inventory_folder` values above. Additionally, you should have at least one example of an AminoAcid, DNASequence, CustomEntity, and Oligo stored within your `inventory_folder`. Tests will copy the examples from the `inventory_folder` for downstream tests. After the tests, conclude, inventory in the `trash_folder` will get archived. #### Happy Cloning!

نیازمندی

مقدار	نام
>=2.22,<3.0	requests
>=0.3.1,<0.4.0	inflection
>=1.0,<2.0	urlopen
>=0.0.1,<0.0.2	bs4
>=3.2,<4.0	marshmallow

زبان مورد نیاز

مقدار	نام
>=3.5.2,<4.0.0	Python

نحوه نصب

نصب پکیج whl benchlingapi-2.1.9:

pip install benchlingapi-2.1.9.whl

نصب پکیج tar.gz benchlingapi-2.1.9:

pip install benchlingapi-2.1.9.tar.gz