معرفی شرکت ها

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

تبلیغات ما

مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.

مشاهده بیشتر

توضیحات

Open Source Transcription Initiation Rates

ویژگی	مقدار
سیستم عامل	OS Independent
نام فایل	OSTIR-1.0.6
نام	OSTIR
نسخه کتابخانه	1.0.6
نگهدارنده	[]
ایمیل نگهدارنده	[]
نویسنده	Cameron Roots, Jeffrey Barrick, Alexandra Lukasiewicz
ایمیل نویسنده	croots@utexas.edu
آدرس صفحه اصلی	https://github.com/barricklab/ostir
آدرس اینترنتی	https://pypi.org/project/OSTIR/
مجوز	-

# OSTIR (Open Source Translation Initiation Rates) [![Status](https://github.com/barricklab/ostir/actions/workflows/package_and_test.yml/badge.svg)](https://github.com/barricklab/ostir/actions/workflows/package_and_test.yml) [![status](https://joss.theoj.org/papers/43d02b32408a161e608b886f63e753c1/status.svg)](https://joss.theoj.org/papers/43d02b32408a161e608b886f63e753c1) `OSTIR` is a Python package for predicting the rates at which ribosomes will bind to and initiate translation from different start codons in bacterial mRNAs. It uses the ViennaRNA Package to perform the necessary free energy calculations. The code builds on the last open source version of the [RBS calculator](https://github.com/hsalis/Ribosome-Binding-Site-Calculator-v1.0). `OSTIR` includes several improvements in usability. It supports multi-FASTA input with command line parameters or CSV input that can define parameters on a per-sequence basis. Additionally, `OSTIR` supports multi-threaded execution, accelerating the analysis of very large sequences. ### [Please see the OSTIR Wiki for full documentation](https://github.com/barricklab/ostir/wiki) # Quickstart ## Installation [![install with bioconda](https://img.shields.io/badge/install%20with-bioconda-brightgreen.svg?style=flat)](http://bioconda.github.io/recipes/ostir/README.html) `OSTIR` is a Python module and associated command line script. We recommend installing `OSTIR` using [Bioconda](https://bioconda.github.io/) on Linux or macOS. This will automatically install `OSTIR` and all of its dependencies, including [ViennaRNA](https://www.tbi.univie.ac.at/RNA/) and the required Python modules. From Bioconda (recommended; Linux, macOS): - Run `conda install -c bioconda ostir` From Pip (for experts; Linux, macOS, Windows): - Download and install ViennaRNA, following the instructions [here](https://www.tbi.univie.ac.at/RNA/). - Run `pip install ostir` For information on installing for development see the [Wiki Documentation](https://github.com/barricklab/ostir/wiki/Installation). ## Command Line Usage Print OSTIR help: ``` ostir -h ``` Run OSTIR on a sequence provided at the command line and print output to the console: ``` ostir -i TTCTAGATGAGAATAAGGTTATGGCGAGCTCTGAAGACGTTATCAAAGAGTTCATGCGTTTCAAAGTTCGTATGGAAGGT ``` Run OSTIR on all sequences provided in a FASTA file and print output to a CSV file: ``` ostir -i input.fasta -o output.csv ``` More options and examples are described in the [Wiki Documentation](https://github.com/barricklab/ostir/wiki/Command-Line-Usage). ## Python Module Usage Run OSTIR on a sequence inside of a Python script: ```python3 from ostir.ostir import run_ostir seq = "ACUUCUAAUUUAUUCUAUUUAUUCGCGGAUAUGCAUAGGAGUGCUUCGAUGUCAU" results = run_ostir(seq, name="my_sequence", threads=8) print(results) ``` More options and examples are described in the [Wiki Documentation](https://github.com/barricklab/ostir/wiki/Python-Module-Usage).

زبان مورد نیاز

مقدار	نام
>=3.8	Python

نحوه نصب

نصب پکیج whl OSTIR-1.0.6:

pip install OSTIR-1.0.6.whl

نصب پکیج tar.gz OSTIR-1.0.6:

pip install OSTIR-1.0.6.tar.gz