معرفی شرکت ها
GetTransTool-0.0.7
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشتر
تبلیغات ما
مشتریان به طور فزاینده ای آنلاین هستند. تبلیغات می تواند به آنها کمک کند تا کسب و کار شما را پیدا کنند.
مشاهده بیشترتوضیحات
Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.
| ویژگی | مقدار |
|---|---|
| سیستم عامل | OS Independent |
| نام فایل | GetTransTool-0.0.7 |
| نام | GetTransTool |
| نسخه کتابخانه | 0.0.7 |
| نگهدارنده | [] |
| ایمیل نگهدارنده | [] |
| نویسنده | laojunjun |
| ایمیل نویسنده | 3219030654@stu.cpu.edu.cn |
| آدرس صفحه اصلی | https://github.com/junjunlab/GetTransTool |
| آدرس اینترنتی | https://pypi.org/project/GetTransTool/ |
| مجوز | - |
# GetTransTool Package
There are four types of methods to extract **longest transcript** or **longest CDS regeion with longest transcript** from **transcripts fasta** file or **GTF** file.
---
- 1.Extract longest transcript from gencode transcripts fasta file.
- 2.Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.
- 3.Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.
- 4.Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.
## Install
```shell
$ pip install GetTransTool
```
## Usage
## 1. get longest transcript from gencode transcripts fasta file:
### help infomation:
```shell
$ GetLongestTransFromGencode -h
usage: GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans.fa
Get longest transcripts from gencode transcripts fasta file.
optional arguments:
-h, --help show this help message and exit
-v, --version show program's version number and exit
-f transfile, --file transfile
input your transcripts file with ".gz" format. (gencode.vM28.transcripts.fa.gz)
-o longestfile, --outfile longestfile
output your longest transcript file. (longest_trans.fa)
Thank your for your support, if you have any questions or suggestions please contact me: 3219030654@stu.cpu.edu.cn.
```
### usage:
```shell
$ GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans_gencode.fa
Your job is running, please wait...
Your job is done!
Running with 32.33 seconds!
```
there will be three files produced including **name_changed.fa**, **longest_transcripts_info.csv**, **longest_trans_gencode.fa**.
> name_changed.fa:
```
>4933401J01Rik|ENSMUSG00000102693.2|ENSMUST00000193812.2|1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...
```
> longest_transcripts_info.csv:
this is the longest transcripts exon length information.
```
fullname,gene_name,translength
snoZ196_ENSMUSG00002074855.1|ENSMUST00020182568.1|35,snoZ196,35
snoZ159_ENSMUSG00002075734.1|ENSMUST00020182611.1|87,snoZ159,87
n-R5s93_ENSMUSG00000119639.1|ENSMUST00000240071.1|119,n-R5s93,119
...
```
> longest_trans_gencode.fa:
this is the filtered longest transcript fasta file.
```
>4933401J01Rik|ENSMUSG00000102693.2|ENSMUST00000193812.2|1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...
```
---
## 2. Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database:
### help infomation:
```shell
$ GetLongestTransFromGTF -h
usage: GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa --outfile longest_trans.fa
Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.
optional arguments:
-h, --help show this help message and exit
-v, --version show program's version number and exit
-d databse, --database databse
which annotation database you choose. (default="ensembl", ucsc/ensembl/gencode)
-g gtffile, --gtffile gtffile
input your GTF file with ".gz" format.
-fa genome, --genome genome
your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
-o longestfile, --outfile longestfile
output your longest transcript file. (longest_trans.fa)
Thank your for your support, if you have any questions or suggestions please contact me: 3219030654@stu.cpu.edu.cn.
```
### usage:
```shell
$ GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa --outfile longest_trans_ensembl.fa
Your job is running, please wait...
Your job is done!
Running with 159.51 seconds!
```
for ucsc:
```
$ GetLongestTransFromGTF --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa --outfile longest_trans_ucsc.fa
```
---
## 3. Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.
### help infomation:
```shell
$ GetCDSLongestFromGencode -h
usage: GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans.fa
Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.
optional arguments:
-h, --help show this help message and exit
-v, --version show program's version number and exit
-f transfile, --file transfile
input your protein-coding transcripts file with ".gz" format. (gencode.vM28.pc_transcripts.fa.gz)
-o longestfile, --outfile longestfile
output your longest transcript file. (longest_cds_trans.fa)
Thank your for your support, if you have any questions or suggestions please contact me: 3219030654@stu.cpu.edu.cn.
```
### usage:
```shell
$ GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans_gencode.fa
Your job is running, please wait...
Your job is done!
Running with 17.67 seconds!
```
there will be four files produced including **name_changed.fa**, **All_transcripts_cds_info.csv**, **longest_cds_transcripts_info.csv**, **longest_cds_trans_gencode.fa**.
> name_changed.fa:
```
>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...
```
> All_transcripts_cds_info.csv:
this is the all transcripts cds and exon length information.
```
fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...
```
> longest_cds_transcripts_info.csv:
```
fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...
```
> longest_cds_trans_gencode.fa:
```
>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...
```
---
## 4. Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.
### help infomation:
```shell
$ GetCDSLongestFromGTF -h
usage: GetCDSLongestFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans.fa
Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.
optional arguments:
-h, --help show this help message and exit
-v, --version show program's version number and exit
-d databse, --database databse
which annotation database you choose. (default="ensembl", ucsc/ensembl)
-g gtffile, --gtffile gtffile
input your GTF file with ".gz" format.
-fa genome, --genome genome
your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
-o cdslongestfile, --outfile cdslongestfile
output your longest transcript file. (longest_cds_trans.fa)
Thank your for your support, if you have any questions or suggestions please contact me: 3219030654@stu.cpu.edu.cn.
```
### usage:
```shell
$ GetCDSLongestFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans_ensembl.fa
Your job is running, please wait...
Your job is done!
Running with 152.38 seconds!
```
for ucsc:
```shell
$ GetCDSLongestFromGTF --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_cds_trans_ensembl.fa
```
---
## END
> Thank your for your support, if you have any questions or suggestions please contact me: 3219030654@stu.cpu.edu.cn.
زبان مورد نیاز
| مقدار | نام |
|---|---|
| >=3.6 | Python |
نحوه نصب
نصب پکیج whl GetTransTool-0.0.7:
pip install GetTransTool-0.0.7.whl
نصب پکیج tar.gz GetTransTool-0.0.7:
pip install GetTransTool-0.0.7.tar.gz